C - Chemistry – Metallurgy – 07 – H
Patent
C - Chemistry, Metallurgy
07
H
C07H 21/04 (2006.01) A61K 48/00 (2006.01) C07H 21/00 (2006.01) C07H 21/02 (2006.01) C12N 15/11 (2006.01) C12N 15/85 (2006.01) C12N 15/86 (2006.01) C12P 19/34 (2006.01) C12Q 1/68 (2006.01) A61K 38/00 (2006.01)
Patent
CA 2475433
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2'-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2'- deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5- methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
La présente invention a trait à un composé constitué d'un oligonucléotide de séquence CAGCAGCAGAGTCTTCATCAT, dans lequel l'oligonucléotide présente un squelette de phosphorothioate d'un bout à l'autre, les groupes fonctionnels de sucre des nucléotides 1-4 et 18-21 portent des modifications de 2'-O-méthoxyéthyle, et les nucléotides restants (les nucléotides 5-17) sont des 2'-désoxynucléotides, et dans lequel les cytosines des nucléotides 1, 4 et 19 sont des 5-méthylcytosines. Le composé présente une stabilité accrue in vivo et une activité antitumorale améliorée in vitro et in vivo.
Gleave Martin
Miyake Hideaki
Monia Brett P.
Nelson Colleen
Rennie Paul S.
Smart & Biggar
The University Of British Columbia
LandOfFree
Trpm-2 antisense therapy using an oligonucleotide having... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Trpm-2 antisense therapy using an oligonucleotide having..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Trpm-2 antisense therapy using an oligonucleotide having... will most certainly appreciate the feedback.
Profile ID: LFCA-PAI-O-1389724