A - Human Necessities – 61 – K
Patent
A - Human Necessities
61
K
A61K 31/7088 (2006.01) C12N 15/11 (2006.01)
Patent
CA 2696460
Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and /n vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5' TCGTCGTTTTCGGCGCGCGCCGT 3' (SEQ ID NO 1), in which each C is unmethylated and 3' refers to the 31 end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-.gamma.. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
L'invention porte sur des oligonucléotides immunostimulateurs qui contiennent un motif immunostimulateur CpG et un second motif qui est capable de former une structure secondaire comprenant des structures duplex et d'ordre supérieur in vitro et in vivo. Ces oligonucléotides immunostimulateurs comprennent des acides nucléiques ou des sels pharmaceutiquement acceptables de ceux-ci ayant des séquences de bases qui comprennent 5' TCGTCGTTTTCGGCGCGCGCCGT 3' (SEQ ID N°1), dans lesquelles chaque C est non méthylé et 3' désigne l'extrémité 3' de l'acide nucléique. Les oligonucléotides activent les lymphocytes B et les lymphocytes NK et induisent l'expression d'un interféron de type I et de l'interféron ?. Les oligonucléotides sont utiles pour traiter une diversité de troubles et d'états, comprenant l'allergie, l'asthme, une infection et le cancer. En plus de leur utilisation en tant qu'agents individuels et en tant que polythérapies, les oligonucléotides décrits sont utiles en tant qu'adjuvants dans des vaccins.
Hanson Douglas Charles
Krieg Arthur M.
Samulowitz Ulrike
Uhlmann Eugen
Vollmer Jorg
Coley Pharmaceutical Gmbh
Coley Pharmaceutical Group Inc.
Pfizer Inc.
Smart & Biggar
LandOfFree
Combination motif immune stimulatory oligonucleotides with... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Combination motif immune stimulatory oligonucleotides with..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Combination motif immune stimulatory oligonucleotides with... will most certainly appreciate the feedback.
Profile ID: LFCA-PAI-O-1504233