C - Chemistry – Metallurgy – 07 – H
Patent
C - Chemistry, Metallurgy
07
H
C07H 21/04 (2006.01) C12N 15/38 (2006.01) C12Q 1/68 (2006.01) C12Q 1/70 (2006.01)
Patent
CA 2344286
The present invention relates to methods for detecting viral pathogens, particularly human herpes virus 6 (HHV6), preferably using polymerase chain reaction (PCR) techniques. The present invention also relates to primer sequences useful in these methods. In a first aspect, the present invention consists in an isolated nucleic acid molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from the group consisting of 5'CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO:1), 5'ACAATTGCCATTTCGGGGAAGTAC (SEQ ID NO:2),and functionally equivalent sequences. A method for detecting HHV6 in a sample suspected of containing HHV6, the method comprising the steps of: (a) optionally amplifying viral DNA present in the sample by polymerase chain reaction techniques using outer primers complementary to the viral DNA; (b) adding to the sample, or to the sample having undergone optional amplification step (a), a pair of inner oligonucleotide primers complementary to and specific for HHV6 DNA, wherein the inner primers comprise the sequences 5'AAGCTTGCACAATGCCAAAAAACAG and 5'CTCGAGTATGCCGAGACCCCTAATC, or functionally equivalent sequences; (c) carrying out polymerase chain reaction techiques on the sample so as to amplify the HHV6 DNA spanned by the inner primers present in the sample; and (d) detecting the amplified HHV6 DNA.
La présente invention concerne des méthodes visant à détecter des agents pathogènes viraux, en particulier le virus 6 de l'herpès humain (HHV6), de préférence au moyen de techniques fondées sur la réaction en chaîne de la polymérase (PCR). L'invention concerne également des séquences amorces convenant pour ces méthodes. Un premier aspect de l'invention concerne une molécule d'acide nucléique isolée complémentaire et spécifique de l'ADN du virus 6 de l'herpès humain (HHV6), qui comprend une séquence sélectionnée dans le groupe constitué par: 5'CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO:1), 5'ACAATTGCCATTTCGGGGAAGTAC (SEQ ID NO:2), et les séquences fonctionnellement équivalentes. L'invention concerne également une méthode permettant de détecter le virus HHV6 dans un échantillon suspecté de le contenir. Cette méthode consiste à: (a) amplifier éventuellement l'ADN viral présent dans l'échantillon au moyen de techniques fondées sur la réaction en chaîne de la polymérase, faisant intervenir des amorces externes complémentaires de l'ADN viral; (b) ajouter directement à l'échantillon original ou à l'échantillon ayant fait l'objet de l'amplification une paire d'amorces internes d'oligonucléides complémentaires et spécifiques de l'ADN du HHV6, ces amorces internes comprenant les séquences 5'AAGCTTGCACAATGCCAAAAAACAG et 5'CTCGAGTATGCCGAGACCCCTAATC ou les séquences fonctionnellement équivalentes; (c) appliquer à l'échantillon les techniques fondées sur la réaction en chaîne de la polymérase de façon à amplifier l'ADN du HHV6 couvert par les amorces internes présentes dans l'échantillon; et (d) détecter l'ADN amplifié du HHV6.
Cunningham Anthony Lawrence
Ratnamohan Vigneswary Mala
Ogilvy Renault Llp/s.e.n.c.r.l.,s.r.l.
Westmead Institute Of Health Research
LandOfFree
Detection of human herpes virus 6 (hhv6) does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Detection of human herpes virus 6 (hhv6), we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Detection of human herpes virus 6 (hhv6) will most certainly appreciate the feedback.
Profile ID: LFCA-PAI-O-1918336