Identification of bacteria by amplification and probing

Details Identification of bacteria by amplification and probing Identification of bacteria by amplification and probing

C - Chemistry, Metallurgy

12

Q

C12Q 1/68 (2006.01)

Patent

CA 2363678

A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5'GCGATTTCYGAAYGGGGRAACCC, the other primer consisting of DNA having the sequence 5'TTCGCCTTTCCCTCACGGTACT and testing the resulting amplicon by hybridisation to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp, Pneumococci, and coagulase negative Staphylococci. One or more novel oligonucleotides for use in this test are immobilised on a solid carrier and incorporated in a diagnostic test kit for use in hospitals and other environments.

Cette invention se rapporte à un procédé permettant d'identifier des bactéries dans un échantillon, qui consiste à amplifier une partie de l'ADNr 23S présent dans l'échantillon, en utilisant, comme première amorce, un jeu d'amorces de dégénérescence comprenant une ou plusieurs molécules d'ADN composées essentiellement par l'ADN ayant la ou les séquences: 5'GCGATTTCYGAAYGGGGRAACCC, l'autre amorce étant composée par l'ADN ayant la séquence: 5'TTCGCCTTTCCCTCACGGTACT; et à tester l'amplicon qui en résulte par hybridation avec une ou plusieurs sondes oligonucléotidiques désignées pour identifier une ou plusieurs bactéries susceptibles d'être présentes dans l'échantillon. Ce procédé permet d'identifier au moins huit espèces bactériennes et beaucoup plus, en un seul test, tel que Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci et Staphylococci négatifs de coagulase. Un ou plusieurs nouveaux oligonucléotides conçus pour être utilisés dans ce test sont immobilisés sur un support solide et incorporés dans un kit de test diagnostique à utiliser en milieu hospitalier et autres.

Affiliated with

Also associated with

Rating

Identification of bacteria by amplification and probing does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Identification of bacteria by amplification and probing, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Identification of bacteria by amplification and probing will most certainly appreciate the feedback.

Rate now

Comments { 0 }

Profile ID: LFCA-PAI-O-2049829