Molecular probes for dna specific for the male genome of...

C - Chemistry – Metallurgy – 12 – Q

Patent

Rate now

  [ 0.00 ] – not rated yet Voters 0   Comments 0

Details

195/1.12, 150/8.

C12Q 1/68 (2006.01) C07H 21/00 (2006.01) C12N 15/10 (2006.01) C12P 19/34 (2006.01)

Patent

CA 1312565

ABSTRACT OF THE DISCLOSURE A molecular probe is provided for DNA specific for the male genome of bovines of the genera Bos and Bison. The molecular probe comprises a nucleic acid segment of: (i) a DNA segment of 49 base pairs length having the following 5'-3' nucleotide sequence, being designated by the name b.c.1.2: 5' 3' ATCAGTGCAGGGACCGAGATGTGCTCCAAGGAGTGTTTATCGGCTGCTT; or (ii) a DNA segment containing at least 11 consecutive nucleotides of the sequence; or (iii) any nucleic acid segment having a sequence homologous or complementary to the sequence of the abovementioned DNA segments. That probe hybridizes, with a sequence being repeated at least 2000 times in the male genome of the genera Bos and Bison. The probe has a hybridization profile, determined by hybridization with male genomic DNA digested by EcoRI. This reveals the presence of a band of the order of 7 kb which is specific for the male genome of the genera Bos and Bison.

530626

LandOfFree

Say what you really think

Search LandOfFree.com for Canadian inventors and patents. Rate them and share your experience with other people.

Rating

Molecular probes for dna specific for the male genome of... does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Molecular probes for dna specific for the male genome of..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Molecular probes for dna specific for the male genome of... will most certainly appreciate the feedback.

Rate now

     

Profile ID: LFCA-PAI-O-1251852

  Search
All data on this website is collected from public sources. Our data reflects the most accurate information available at the time of publication.