C - Chemistry – Metallurgy – 12 – Q
Patent
C - Chemistry, Metallurgy
12
Q
195/1.12, 150/8.
C12Q 1/68 (2006.01) C07H 21/00 (2006.01) C12N 15/10 (2006.01) C12P 19/34 (2006.01)
Patent
CA 1312565
ABSTRACT OF THE DISCLOSURE A molecular probe is provided for DNA specific for the male genome of bovines of the genera Bos and Bison. The molecular probe comprises a nucleic acid segment of: (i) a DNA segment of 49 base pairs length having the following 5'-3' nucleotide sequence, being designated by the name b.c.1.2: 5' 3' ATCAGTGCAGGGACCGAGATGTGCTCCAAGGAGTGTTTATCGGCTGCTT; or (ii) a DNA segment containing at least 11 consecutive nucleotides of the sequence; or (iii) any nucleic acid segment having a sequence homologous or complementary to the sequence of the abovementioned DNA segments. That probe hybridizes, with a sequence being repeated at least 2000 times in the male genome of the genera Bos and Bison. The probe has a hybridization profile, determined by hybridization with male genomic DNA digested by EcoRI. This reveals the presence of a band of the order of 7 kb which is specific for the male genome of the genera Bos and Bison.
530626
Bishop Colin
Cotinot Corinne
Fellous Marc
Kirszenbaum Marek
Vaiman Marcel
Bishop Colin
Commissariat A. L'energie Atomique (cea)
Cotinot Corinne
Fellous Marc
Institut National de La Recherche Agronomique (inra)
LandOfFree
Molecular probes for dna specific for the male genome of... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Molecular probes for dna specific for the male genome of..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Molecular probes for dna specific for the male genome of... will most certainly appreciate the feedback.
Profile ID: LFCA-PAI-O-1251852