Mutant aox2 promoter, vector carrying same, transformant,...

C - Chemistry – Metallurgy – 12 – N

Patent

Rate now

  [ 0.00 ] – not rated yet Voters 0   Comments 0

Details

C12N 15/81 (2006.01) C12N 1/19 (2006.01) C12N 15/11 (2006.01) C12N 15/14 (2006.01) C12N 15/20 (2006.01) C12N 15/58 (2006.01) C12P 21/02 (2006.01)

Patent

CA 2128794

A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT is(are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying said promoter, a transformant into which said vector has been introduced and a method for producing a heterologous protein, comprising culture of said transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.

LandOfFree

Say what you really think

Search LandOfFree.com for Canadian inventors and patents. Rate them and share your experience with other people.

Rating

Mutant aox2 promoter, vector carrying same, transformant,... does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Mutant aox2 promoter, vector carrying same, transformant,..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Mutant aox2 promoter, vector carrying same, transformant,... will most certainly appreciate the feedback.

Rate now

     

Profile ID: LFCA-PAI-O-1855850

  Search
All data on this website is collected from public sources. Our data reflects the most accurate information available at the time of publication.