C - Chemistry – Metallurgy – 12 – N
Patent
C - Chemistry, Metallurgy
12
N
C12N 15/81 (2006.01) C12N 1/19 (2006.01) C12N 15/11 (2006.01) C12N 15/14 (2006.01) C12N 15/20 (2006.01) C12N 15/58 (2006.01) C12P 21/02 (2006.01)
Patent
CA 2128794
A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT is(are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment of a wild-type AOX2 promoter, a vector carrying said promoter, a transformant into which said vector has been introduced and a method for producing a heterologous protein, comprising culture of said transformant. The mutant AOX2 promoter of the present invention has a markedly enforced promoter activity as compared with wild-type AOX2 promoters. Accordingly, the promoter of the present invention is highly utilizable as a promoter to be carried by a vector capable of expressing a heterologous protein. The vector of the present invention can efficiently express and produce various useful heterologous proteins in hosts.
Hiramatsu Ryuji
Miura Masami
Ohi Hideyuki
Ohmura Takao
Fetherstonhaugh & Co.
Mitsubishi Pharma Corporation
The Green Cross Corporation
LandOfFree
Mutant aox2 promoter, vector carrying same, transformant,... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Mutant aox2 promoter, vector carrying same, transformant,..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Mutant aox2 promoter, vector carrying same, transformant,... will most certainly appreciate the feedback.
Profile ID: LFCA-PAI-O-1855850