C - Chemistry – Metallurgy – 12 – Q
Patent
C - Chemistry, Metallurgy
12
Q
C12Q 1/68 (2006.01)
Patent
CA 2551627
The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.
L'invention porte sur une paire d'amorces, soit: une amorce directe SEQ ID NO. 1 présentant la séquence CCAAGCTTGCTGAACGCATCGG, et une amorce inverse SEQ ID No. 2 présentant la séquence CCAAGCTTGCCACGCAGGATTATC, et sur une méthode de criblage permettant l'identification précoce de plantes Artemisia annua à forte teneur en artémisinine et favorisant de ce fait la génération de populations de plantes à teneur renforcée en artémisinine.
Darokar Mahendra Pandurang
Gupta Madan Mohan
Khanuja Suman Preet Singh
Kumar Anuruddha
Paul Shilpi
Council Of Scientific And Industrial Research
Smart & Biggar
LandOfFree
Primers and a screening method for identification of... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Primers and a screening method for identification of..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Primers and a screening method for identification of... will most certainly appreciate the feedback.
Profile ID: LFCA-PAI-O-1892274