Primers and a screening method for identification of...

C - Chemistry – Metallurgy – 12 – Q

Patent

Rate now

  [ 0.00 ] – not rated yet Voters 0   Comments 0

Details

C12Q 1/68 (2006.01)

Patent

CA 2551627

The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua having high content of artemisinin and thereby helping generation of plant population with further high content of artemisinin.

L'invention porte sur une paire d'amorces, soit: une amorce directe SEQ ID NO. 1 présentant la séquence CCAAGCTTGCTGAACGCATCGG, et une amorce inverse SEQ ID No. 2 présentant la séquence CCAAGCTTGCCACGCAGGATTATC, et sur une méthode de criblage permettant l'identification précoce de plantes Artemisia annua à forte teneur en artémisinine et favorisant de ce fait la génération de populations de plantes à teneur renforcée en artémisinine.

LandOfFree

Say what you really think

Search LandOfFree.com for Canadian inventors and patents. Rate them and share your experience with other people.

Rating

Primers and a screening method for identification of... does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Primers and a screening method for identification of..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Primers and a screening method for identification of... will most certainly appreciate the feedback.

Rate now

     

Profile ID: LFCA-PAI-O-1892274

  Search
All data on this website is collected from public sources. Our data reflects the most accurate information available at the time of publication.