C - Chemistry – Metallurgy – 12 – Q
Patent
C - Chemistry, Metallurgy
12
Q
C12Q 1/68 (2006.01)
Patent
CA 2539535
A method of detecting a neurodegenerative disease in a mammal, which method comprises assaying the copy number of a Cripto-1 gene or the expression level of a Cripto-1 gene product in the central nervous system of the mammal, wherein an amplification of the Cripto-1 gene or an overexpression of the Cripto-1 gene product is indicative of a neurodegenerative disease in the mammal; a method of inhibiting progression of a neurodegenerative disease in a mammal, which method comprises administering to the mammal an agent that inhibits Cripto-1 in an amount effective to inhibit Cripto-1 in the central nervous system of the mammal, whereupon the progression of the neurodegenerative disease is inhibited; and an isolated or purified oligonucleotide consisting essentially of the sequence of AAGCTATGGACTGCAGGAAGATGG (SEQ ID NO: 3) or AGAAGGCAGATGCCACTAGC (SEQ ID NO: 4).
L'invention concerne une méthode de détection d'une maladie neurodégénérative chez un mammifère, qui consiste à analyser le numéro d'exemplaire du gène crypto-1 ou le niveau d'expression d'un produit du gène crypto-1 dans le système nerveux central du mammifère, une amplification du gène crypto-1 ou une surexpression du produit du gène crypto-1 signalant une maladie neurodégénérative chez le mammifère. L'invention porte également sur une méthode d'inhibition de la progression d'une maladie neurodégénérative chez un mammifère, qui consiste à administrer au mammifère un agent qui inhibe crypto-1 dans le système nerveux central du mammifère, la progression de la maladie neurodégénérative étant ainsi inhibée. L'invention se rapporte également à un oligonucléotide purifié se composant essentiellement de la séquence AAGCTATGGACTGCAGGAAGATGG (SEQ ID NO: 3) ou AGAAGGCAGATGCCACTAGC (SEQ ID NO: 4).
Berman Nancy
Salomon David
Stephens Edward
Department Of Health And Human Services Government Of The United States Of America Represented By The Se
Ridout & Maybee Llp
University Of Kansas Medical Center
LandOfFree
Use of cripto-1 as a biomarker for neurodegenerative disease... does not yet have a rating. At this time, there are no reviews or comments for this patent.
If you have personal experience with Use of cripto-1 as a biomarker for neurodegenerative disease..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Use of cripto-1 as a biomarker for neurodegenerative disease... will most certainly appreciate the feedback.
Profile ID: LFCA-PAI-O-1477418