Method and probes for the genetic diagnosis of hereditary...

C - Chemistry – Metallurgy – 12 – Q

Patent

Rate now

  [ 0.00 ] – not rated yet Voters 0   Comments 0

Details

C12Q 1/68 (2006.01)

Patent

CA 2426171

The invention relates to a diagnostic method for haemochromatosis. According to the inventive method, either a biological sample is analysed for the presence of the nucleotide sequence 5'cccgccgtggcccagctcgcagggcagctcctc 3' (sequence no. 3) instead of the nucleotide sequence 5'cccgccgtggcccaggccgtggcccagctcgcagggcagctcctc 3' (sequence no. 2), on the basis of a 12-nucleotide-long deletion in the exon 16 of the TFR2 cDNA sequence, or a biological sample is analysed for the presence of nucleic acids coding for a TFR2 product having an amino acid sequence Pro Ala Val Ala Gin <u>Leu Ala Gly Gin</u> Leu Leu (sequence no. 5) instead of the amino acid sequence Pro Ala Val Ala Gin <u>Ala Val Ala Gin</u> Leu Ala Gly Gin Leu Leu (sequence no. 4), or for the presence of a TFR2 gene product having an amino acid sequence Pro Ala Val Ala Gin <u>Leu Ala Gly Gin</u> Leu Leu (sequence no. 5) instead of the amino acid sequence Pro Ala Val Ala Gin <u>Ala Val</u> <u>Ala Gin</u> Leu Ala Gly Gin Leu Leu (sequence no. 4). According to the invention, a probe for diagnosing haemochromatosis is capable of hybridisation with nucleic acids of a biological sample in a region containing the nucleotide sequence 5' cccgccgtggcccagctcgcagggcagctcctc 3' (sequence no. 3) in the exon 16 of the TFR2 cDNA sequence.

Dans le cas d'un procédé de diagnostic d'une hémochromatose, on examine une sonde biologique selon l'invention pour déceler l'éventuelle présence de la séquence de nucléotides 5'cccgccgtggcccagctcgcagggcagctcctc 3' (séquence n·3) à la place de la séquence de nucléotides 5'cccgccgtggcccaggccgtggcccagctcgcagggcagctcctc 3' (séquence n·2) en raison d'une délétion d'une longueur de 12 nucléotides dans l'exon 16 de la séquence ADNc TFR2 . Ou bien selon l'invention, on examine une sonde biologique pour déceler l'éventuelle présence d'acides nucléiques codants pour un produit TFR2 ayant une séquence d'acides aminés Pro Ala Val Ala Gln <u>Leu Ala Gly Gln</u> Leu Leu (séquence n· 5) à la place de la séquence d'acides aminés Pro Ala Val Ala Gln <u>Ala Val Ala Gln</u> Leu Ala Gly Gln Leu Leu (séquence n· 4) ou l'éventuelle présence d'un produit génique TFR2 ayant une séquence d'acides aminés Pro Ala Val Ala Gln <u>Leu Ala Gly Gln</u> Leu Leu (séquence n· 5) à la place de la séquence d'acides aminés Pro Ala Val Ala Gln <u>Ala Val</u> <u>Ala Gln</u> Leu Ala Gly Gln Leu Leu (séquence n· 4). Une sonde de diagnostic d'une hémochromatose est selon l'invention capable d'hybridation avec les acides nucléiques d'une sonde biologique dans une plage qui contient la séquence de nucléotides 5' cccgccgtggcccagctcgcagggcagctcctc 3' (séquence n· 3) dans l'exon 16 de la séquence ADN.¿C? TFR2.

LandOfFree

Say what you really think

Search LandOfFree.com for Canadian inventors and patents. Rate them and share your experience with other people.

Rating

Method and probes for the genetic diagnosis of hereditary... does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Method and probes for the genetic diagnosis of hereditary..., we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Method and probes for the genetic diagnosis of hereditary... will most certainly appreciate the feedback.

Rate now

     

Profile ID: LFCA-PAI-O-1501739

  Search
All data on this website is collected from public sources. Our data reflects the most accurate information available at the time of publication.