Gender test method

C - Chemistry – Metallurgy – 12 – Q

Patent

Rate now

  [ 0.00 ] – not rated yet Voters 0   Comments 0

Details

C12Q 1/68 (2006.01) C07H 21/04 (2006.01)

Patent

CA 2096278

RAN 4095/83 ABSTRACT The present invention relates to a method for determining the gender of a human being based on a DNA sample originating from said human being. In one embodiment of the invention, the oligonucleotide primers CTGGAGAGCCACAAGCTGAC (SEQ ID NO:l); and TTGCTGTGGACTGCCAAGAG (SEQ ID NO:2) are used to amplify an approximately 209 base pair conserved region of the X and Y zinc finger protein coding sequence. Then, digestion of the amplified product with a HaeIII restriction enzyme results in distinguishable fragments for female and male samples. The invention also relates to the said oligonucleotide primers per se, preferably in labeled form, to the use of said primers as a diagnostic tool and to a test kit comprising said oligonucleotide primers.

LandOfFree

Say what you really think

Search LandOfFree.com for Canadian inventors and patents. Rate them and share your experience with other people.

Rating

Gender test method does not yet have a rating. At this time, there are no reviews or comments for this patent.

If you have personal experience with Gender test method, we encourage you to share that experience with our LandOfFree.com community. Your opinion is very important and Gender test method will most certainly appreciate the feedback.

Rate now

     

Profile ID: LFCA-PAI-O-1597619

  Search
All data on this website is collected from public sources. Our data reflects the most accurate information available at the time of publication.